Filters
Technology
Platform
GSE3330
Mus musculus
60 Downloadable Samples
Affymetrix Mouse Expression 430A Array (moe430a)
Description
Coordinated regulation of gene expression levels across a series of experimental conditions provides valuable information about the functions of correlated transcripts. To map gene regulatory pathways, we used microarray-derived gene expression measurements in 60 individuals of an F2 sample segregating for diabetes. We performed correlation analysis among ~40,000 expression traits. By combining correlation among expression traits and linkage mapping information, we were able to identify regulatory networks, make functional predictions to uncharacterized genes, and characterize novel members of known pathways. Using 36 seed traits, we found evidence of coordinate regulation of 160 G-protein coupled receptor (GPCR) pathway expression traits. Of the 160 traits, 50 had their major LOD peak within 8 cM of a locus on chromosome 2, and 81 others had a secondary peak in this region. A previously uncharacterized Riken cDNA clone, which showed strong correlation with stearoyl CoA desaturase 1 expression, was experimentally validated to be responsive to conditions that regulate lipid metabolism. Using linkage mapping, we identified multiple genes whose expression is under the control of transcription regulatory loci. Trait-correlation combined with linkage mapping can reveal regulatory networks that would otherwise be missed if we only studied mRNA traits with statistically significant linkages in this small cross. The combined analysis is more sensitive compared with linkage mapping only.
Publication Title
Combined expression trait correlations and expression quantitative trait locus mapping.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 30 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Genes responses in A549 and H460 cells after GSI (RO4929097-001-003 , 2 uM) treatment.
Publication Title
Preclinical profile of a potent gamma-secretase inhibitor targeting notch signaling with in vivo efficacy and pharmacodynamic properties.
Sample Metadata Fields
Cell line, Treatment, Time
View Samples- Mus musculus
- 14 Downloadable Samples
- Affymetrix Mouse Expression 430A Array (moe430a)
Description
To uncover molecular mechanisms specifically involved in the pathogenesis of colitis-associated colon cancer (CAC), we studied tumorigenesis in experimental models of CAC and sporadic CRC that mimic characteristics of human CRC. Using comparative whole genome expression profiling, we observed differential expression of epiregulin (Ereg) in mouse models of colitis-associated, but not sporadic colorectal cancer. Similarly, highly significant upregulation of Ereg expression was found in cohorts of patients with colitis-associated cancer in inflammatory bowel disease but not in sporadic colorectal cancer. Furthermore, tumor-associated fibroblasts were identified as major source of Ereg in colitis-associated neoplasias. Functional studies showed that Ereg-deficient mice, although more prone to colitis, are strongly protected from colitis-associated tumors, and data from serial endoscopic studies revealed that Ereg promotes growth rather than initiation of tumors.
Publication Title
Tumor fibroblast-derived epiregulin promotes growth of colitis-associated neoplasms through ERK.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Saccharomyces cerevisiae
- 6 Downloadable Samples
- Affymetrix Yeast Genome 2.0 Array (yeast2)
Description
Altered mRNA levels of HBT1 were observed in S. cerevisiae cells expressing hsc82-W296A compared to WT HSC82. We conducted microarray analysis to determine the extent of other changes in that strain.
Publication Title
Identification of an Hsp90 mutation that selectively disrupts cAMP/PKA signaling in Saccharomyces cerevisiae.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Previous studies have reported that human pluripotent stem cells (hPSCs) generate dorsal forebrain, cortical-like neurons under default differentiation in the absence of patterning morphogens. Novel bioinformatic analyses of whole transcriptome data allow us to examine these cells' regional specification more comprehensively. Furthermore, these tools allow us to ask how well hPSNs mimic their endogenous counterparts during various stages of in vivo human brain development.
Publication Title
Default Patterning Produces Pan-cortical Glutamatergic and CGE/LGE-like GABAergic Neurons from Human Pluripotent Stem Cells.
Sample Metadata Fields
Sex, Specimen part, Time
View Samples- Homo sapiens
- 39 Downloadable Samples
- Affymetrix Human Exon 1.0 ST Array [transcript (gene) version (huex10st)
Description
OBJECTIVE: Previous expression microarray analyses have failed to take into consideration the genetic heterogeneity and complex patterns of ERG gene alteration frequently found in cancerous prostates. The objective of this study is for the first time, to integrate the mapping of ERG gene alterations with the collection of expression microarray data.
Publication Title
Integration of ERG gene mapping and gene-expression profiling identifies distinct categories of human prostate cancer.
Sample Metadata Fields
Sex, Specimen part
View Samples- Ovis aries
- 4 Downloadable Samples
- Affymetrix Bovine Genome Array (bovine)
Description
Reverse genetics has been widely used to investigate function of viral genes. In the present study we investigated the gene expression profile of a primary ovine cell (OFTu) in response to infection with the wild type (OV-IA82) and deletion mutant virus (OV-IA82024) aiming to determine possible functions for ORFV024 during ORFV infection.
Publication Title
A novel inhibitor of the NF-{kappa}B signaling pathway encoded by the parapoxvirus orf virus.
Sample Metadata Fields
Specimen part
View Samples- Danio rerio
- 160 Downloadable Samples
- NextSeq 500
Description
We present ScarTrace, a single-cell sequencing strategy that allows us to simultaneously quantify information on clonal history and cell type for thousands of single cells obtained from different organs from adult zebrafish. Using this approach we show that all blood cells types in the kidney marrow arise from a small set of multipotent embryonic. In contrast, we find that cells in the eyes, brain, and caudal tail fin arise from many embryonic progenitors, which are more restricted and produce specific cell types in the adult tissue. Next we use ScarTrace to explore when embryonic cells commit to forming either left or right organs using the eyes and brain as a model system. Lastly we monitor regeneration of the caudal tail fin and identify a subpopulation of resident macrophages that have a clonal origin that is distinct from other blood cell types. Overall design: Single cell sequencing data from cells isolated from zebrafish organs (whole kidney marrow, forebrain, hindbrain, left eye, right eye, left midbrain, right midbrain, and regenerated fin). For each cell, we provide libraries with transcritpome and with clonal information, respectively.
Publication Title
Whole-organism clone tracing using single-cell sequencing.
Sample Metadata Fields
Specimen part, Subject
View Samples- Mus musculus
- 63 Downloadable Samples
- Illumina MouseWG-6 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
Regulatory T Cells Orchestrate Similar Immune Evasion of Fetuses and Tumors in Mice.
Sample Metadata Fields
Age, Specimen part
View Samples