Neonatal hearts (P2) from wildtype, miR-1-1 null and miR-1-2 +/-: miR-1-1 +/- double heterozygote animals were isolated and total RNA was extracted with TRIzol (Invitrogen), following the manufacturers suggested protocol.
microRNA-1 regulates sarcomere formation and suppresses smooth muscle gene expression in the mammalian heart.
Specimen part
View SamplesTemporal expression profiling was utilized to define transcriptional regulatory pathways in vivo in a mouse muscle regeneration model. Potential downstream targets of MyoD were identified by temporal expression, promoter data base mining, and gel shift assays; Slug and calpain 6 were identified as novel MyoD targets. Slug, a member of the snail/slug family of zinc finger transcriptional repressors critical for mesoderm/ectoderm development, was further shown to be a downstream target by using promoter/reporter constructs and demonstration of defective muscle regeneration in Slug null mice.
Slug is a novel downstream target of MyoD. Temporal profiling in muscle regeneration.
No sample metadata fields
View SamplesThe goal of this study was to identify potential genes regulated by ERG
Aberrant ERG expression cooperates with loss of PTEN to promote cancer progression in the prostate.
No sample metadata fields
View SamplesThe goal of this study is to simultaneously examine host and parasite gene expression programs in skin lesions of human patients infected with the intracellular parasite Leishmania. We conducted high-resolution sequencing of the transcriptomes from early and late stage cutaneous leishmaniasis biopsies using an RNA-seq approach. An array of computational tools was applied to map reads to the Leishmania and human genomes and reconstruct full-length transcripts. mRNA abundance was determined for Leishmania and human genes, helping to explain tuning of the immune response to parasite transcriptomic profiles present in the lesion microenvironment. This data provided a deeper look at the transcriptomic profile of the host response in conjunction with a novel look at the parasite transcriptome in human cutaneous lesions. These data also offer the first glimpse of Leishmania gene expression profiles specific to the cutaneous manifestation of disease in human patients. This metatranscriptomic study provides a solid framework for future functional, genomic, and clinical studies of leishmaniasis as well as intracellular pathogenesis in general.
Meta-transcriptome Profiling of the Human-Leishmania braziliensis Cutaneous Lesion.
No sample metadata fields
View SamplesThis SuperSeries is composed of the SubSeries listed below.
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Age, Specimen part, Cell line, Treatment
View SamplesWe used Kras/Hras/Nras-triple knockout MEFs expressing recombinant Nras to test the off-target effect of 2 Kras siRNAs at different transfection concentrations.
Development of siRNA payloads to target KRAS-mutant cancer.
Specimen part
View SamplesWe analyzed miRNA-based shRNA off-target effects by transducing Trp53-/- MEFs at single- and high-copy with six well-characterized, potent and weak Trp53 shRNAs.
Development of siRNA payloads to target KRAS-mutant cancer.
Specimen part
View SamplesWe performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Specimen part
View SamplesOver half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Cell line
View SamplesWe used microarrays to unveil the gene expression alterations upon short-term HFD administration
Dietary alterations modulate susceptibility to Plasmodium infection.
Specimen part
View Samples