Filters
Technology
Platform
GSE21705
Arabidopsis thaliana
8 Downloadable Samples
Affymetrix Arabidopsis ATH1 Genome Array (ath1121501)
Description
In seed plants, leaves are born on radial shoots but unlike shoots they are determinate dorsiventral organs made of flat lamina. YABBY genes are found only in seed plants and in all cases studied, are expressed primarily in lateral organs and in a polar manner. Despite their simple expression, Arabidopsis plants lacking all YABBY gene activities have a wide range of morphological defects in all lateral organs as well as the shoot apical meristem. Here we show that leaves lacking all YABBY activities are initiated as dorsiventral appendages but fail to properly activate lamina programs. In particular, the activation of most CIN-TCPs does not commence, SAM-specific programs are reactivated, and a marginal leaf domain is not established. Altered distribution of auxin signalling and the auxin efflux carrier PIN1, highly reduced venation, initiation of multiple cotyledons, and gradual loss of the SAM accompany these defects. We suggest that YABBY functions were recruited to mould modified shoot systems into flat plant appendages by translating organ polarity into lamina specific programs that include marginal auxin flow and activation a maturation schedule directing determinate growth.
Publication Title
Differentiating Arabidopsis shoots from leaves by combined YABBY activities.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 12 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Chronic, low-grade adipose tissue inflammation associated with adipocyte hypertrophy is an important link in the relationship between obesity and insulin resistance. Although ubiquitin ligases are essential regulators of inflammatory processes, the role of these enzymes in metabolically driven adipose tissue inflammation is relatively unexplored. In this study, we found that the ubiquitin ligase Siah2 is a central factor in obesity-related adipose tissue inflammation. When challenged with chronic excess energy intake, Siah2-null mice become obese with enlarged adipocytes, but do not develop obesity-induced insulin resistance. Proinflammatory gene expression is substantially reduced in the Siah2-null epididymal adipose tissue of the obese Siah2KO mice.
Publication Title
The ubiquitin ligase Siah2 regulates obesity-induced adipose tissue inflammation.
Sample Metadata Fields
Sex, Age, Specimen part
View Samples- Homo sapiens
- 56 Downloadable Samples
IlluminaHiSeq2000
Description
Systems biology is an approach to comprehensively study complex interactions within a biological system. Most published systems vaccinology studies have utilized whole blood or peripheral blood mononuclear cells (PBMC) to monitor the immune response after vaccination. Because human blood is comprised of multiple hematopoietic cell types, the potential for masking responses of under-represented cell populations is increased when analyzing whole blood or PBMC. To investigate the contribution of individual cell types to the immune response after vaccination, we established a rapid and efficient method to purify human T and B cells, natural killer (NK) cells, myeloid dendritic cells (mDC), monocytes, and neutrophils from fresh venous blood. Purified cells were fractionated and processed in a single day. RNA-Seq and quantitative shotgun proteomics were performed to determine expression profiles for each cell type prior to and after inactivated seasonal influenza vaccination. Our results show that transcriptomic and proteomic profiles generated from purified immune cells differ significantly from PBMC. Differential expression analysis for each immune cell type also shows unique transcriptomic and proteomic expression profiles as well as changing biological networks at early time points after vaccination. This cell type-specific information provides a more comprehensive approach to monitor vaccine responses. Overall design: PBMC and six purified cell types from two vaccinated donors were isolated prior to (d0) and at days 1, 3, and 7 post-TIV vaccination for RNA-seq analysis
Publication Title
A cell-based systems biology assessment of human blood to monitor immune responses after influenza vaccination.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 4 Downloadable Samples
- Affymetrix Human Genome U133A 2.0 Array (hgu133a2)
Description
DNA damage activates a complex signaling network in cells that blocks cell cycle progression, recruits factors involved in DNA repair, and/or triggers programs that control senescence or programmed cell death. Alterations in chromatin structure are known to be important for the initiation and propagation of the DNA damage response, although the molecular details are unclear. We investigated the role of chromatin structure in the DNA damage response by monitoring multiple timedependent checkpoint signaling and response events with a high-content multiplex image-based RNAi screen of chromatin modifying and interacting genes. We discovered that Brd4, a double bromodomain-containing protein, functions as an endogenous inhibitor of DNA damage signaling by binding to acetylated histones at sites of open chromatin and altering chromatin accessibility. Loss of Brd4 or disruption of acetyl-lysine binding results in an increase in both the number and size of radiation-induced !H2AX nuclear foci while overexpression of a Brd4 splice isoform completely suppresses !H2AX formation, despite equivalent double strand break formation. Brd4 knock-down cells displayed altered chromatin structure, prolonged cell cycle checkpoint arrest and enhanced survival after irradiation, while overexpression of Brd4 isoform B results in enhanced radiationinduced lethality. Brd4 is the target of the t(15;19) chromosomal translocation in a rare form of cancer, NUT Midline Carcinoma. Acetyl lysine-bromodomain interactions of the Brd4-NUT fusion protein suppresses !H2AX foci in discrete nuclear compartments, rendering cells more radiosensitive, mimicking overexpression of Brd4 isoform B. NUT Midline Carcinoma is sensitive to radiotherapy, however tumor material from this rare cancer is scarce. We therefore investigated Brd4 expression in another human cancer commonly treated with radiotherapy, glioblastoma multiforme, and found that expression of Brd4 isoform B correlated specifically with treatment response to radiotherapy. These data implicate Brd4 as an endogenous insulator of DNA damage signaling through recognition of epigenetic modifications in chromatin and suggest that expression of the Brd4 in human cancer can modulate the clinical response to DNA-damaging cancer therapy.
Publication Title
The bromodomain protein Brd4 insulates chromatin from DNA damage signalling.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 60 Downloadable Samples
- Affymetrix Mouse Expression 430A Array (moe430a)
Description
Coordinated regulation of gene expression levels across a series of experimental conditions provides valuable information about the functions of correlated transcripts. To map gene regulatory pathways, we used microarray-derived gene expression measurements in 60 individuals of an F2 sample segregating for diabetes. We performed correlation analysis among ~40,000 expression traits. By combining correlation among expression traits and linkage mapping information, we were able to identify regulatory networks, make functional predictions to uncharacterized genes, and characterize novel members of known pathways. Using 36 seed traits, we found evidence of coordinate regulation of 160 G-protein coupled receptor (GPCR) pathway expression traits. Of the 160 traits, 50 had their major LOD peak within 8 cM of a locus on chromosome 2, and 81 others had a secondary peak in this region. A previously uncharacterized Riken cDNA clone, which showed strong correlation with stearoyl CoA desaturase 1 expression, was experimentally validated to be responsive to conditions that regulate lipid metabolism. Using linkage mapping, we identified multiple genes whose expression is under the control of transcription regulatory loci. Trait-correlation combined with linkage mapping can reveal regulatory networks that would otherwise be missed if we only studied mRNA traits with statistically significant linkages in this small cross. The combined analysis is more sensitive compared with linkage mapping only.
Publication Title
Combined expression trait correlations and expression quantitative trait locus mapping.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Saccharomyces cerevisiae
- 6 Downloadable Samples
- Affymetrix Yeast Genome 2.0 Array (yeast2)
Description
Altered mRNA levels of HBT1 were observed in S. cerevisiae cells expressing hsc82-W296A compared to WT HSC82. We conducted microarray analysis to determine the extent of other changes in that strain.
Publication Title
Identification of an Hsp90 mutation that selectively disrupts cAMP/PKA signaling in Saccharomyces cerevisiae.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Previous studies have reported that human pluripotent stem cells (hPSCs) generate dorsal forebrain, cortical-like neurons under default differentiation in the absence of patterning morphogens. Novel bioinformatic analyses of whole transcriptome data allow us to examine these cells' regional specification more comprehensively. Furthermore, these tools allow us to ask how well hPSNs mimic their endogenous counterparts during various stages of in vivo human brain development.
Publication Title
Default Patterning Produces Pan-cortical Glutamatergic and CGE/LGE-like GABAergic Neurons from Human Pluripotent Stem Cells.
Sample Metadata Fields
Sex, Specimen part, Time
View Samples- Ovis aries
- 4 Downloadable Samples
- Affymetrix Bovine Genome Array (bovine)
Description
Reverse genetics has been widely used to investigate function of viral genes. In the present study we investigated the gene expression profile of a primary ovine cell (OFTu) in response to infection with the wild type (OV-IA82) and deletion mutant virus (OV-IA82024) aiming to determine possible functions for ORFV024 during ORFV infection.
Publication Title
A novel inhibitor of the NF-{kappa}B signaling pathway encoded by the parapoxvirus orf virus.
Sample Metadata Fields
Specimen part
View Samples- Danio rerio
- 160 Downloadable Samples
- NextSeq 500
Description
We present ScarTrace, a single-cell sequencing strategy that allows us to simultaneously quantify information on clonal history and cell type for thousands of single cells obtained from different organs from adult zebrafish. Using this approach we show that all blood cells types in the kidney marrow arise from a small set of multipotent embryonic. In contrast, we find that cells in the eyes, brain, and caudal tail fin arise from many embryonic progenitors, which are more restricted and produce specific cell types in the adult tissue. Next we use ScarTrace to explore when embryonic cells commit to forming either left or right organs using the eyes and brain as a model system. Lastly we monitor regeneration of the caudal tail fin and identify a subpopulation of resident macrophages that have a clonal origin that is distinct from other blood cell types. Overall design: Single cell sequencing data from cells isolated from zebrafish organs (whole kidney marrow, forebrain, hindbrain, left eye, right eye, left midbrain, right midbrain, and regenerated fin). For each cell, we provide libraries with transcritpome and with clonal information, respectively.
Publication Title
Whole-organism clone tracing using single-cell sequencing.
Sample Metadata Fields
Specimen part, Subject
View Samples