Filters
Technology
Platform
SRP061276
Zea mays
29 Downloadable Samples
Illumina HiSeq 2000
Description
Plants have developed complex mechanisms to respond and adapt to abiotic stresses, coupling elaborate modulation of gene expression together with the preservation of genome stability. Epigenetic mechanisms - DNA methylation, chromatin modifications and non coding RNAs - were shown to play a fundamental role in stress-induced gene regulation and may also result in genome destabilization, with the activation and/or the transcription of silenced transposons and retroelements, causing genome rearrangements and novel gene expression patterns. Maize leaf transcriptome was analyzed by total RNA-Seq in both B73 and rmr6 (PolIV mutant involved in siRNA biogenesis and in the RdDM pathway) after drought and salt stress application. Reference annotation based transcript assembly allowed the identification both of new expressed loci and splicing variants, improving the current maize transcriptome annotation. Many antisense transcripts matching on the opposite strand of annotated loci were also identified, while more than the 20% of transcripts represent non coding RNA belonging to four classes: siRNAs, shRNAs, lncRNAs and transposable elements (or their relics). Several lncRNAs are modulated by stress application while TE-related sequences are mainly expressed in rmr6 and up-regulated by the stress. Overall design: Total RNA-Seq analysis of maize leaves from wt and rmr6-1 mutant plants grown under 1) control conditions, 2) drought stress, 3) salt stress, 4) salt+drought stress. Each condition was investigated in triplicate after 10 days of treatment and after 7 days of recovery. Samples derived from replicates 2 and 3 were pooled and sequenced together
Publication Title
Maize RNA PolIV affects the expression of genes with nearby TE insertions and has a genome-wide repressive impact on transcription.
Sample Metadata Fields
Treatment, Subject, Time
View Samples- Homo sapiens
- 11 Downloadable Samples
Affymetrix Human Transcriptome Array 2.0 (hta20)
Description
Intrahepatic Cholangiocarcinoma (iCCA) is a deadly disease with rising incidence and few treatment options. Recently, aberrant Notch signaling was reported in iCCA carcinogenesis. Specifically, altered expression and/or activation of the receptors Notch1/2 suggests a role for Notch pathway overactivation during iCCA formation and progression. In this study, we examined the effects of Notch inhibition by γ-secretase inhibitor, LY3039478 in human iCCA cell lines and in an excellent patient derived-xenograft (PDX) model. Expression of several Notch pathway components, including NICD, Hes1, and DLL4, were reduced after GSI treatment. Moreover, LY3039478 inhibits cell migration and invasion while in GSI-treated mice, tumor growth was delayed compared to vehicle and chemotherapy. These results support the notion that Notch inhibition by GSI may reduce in vivo tumorigenesis. In addition, GSI reduces in PDX model VEGFA and MMP13 involved in capillary tube formation and tumor progression. Here, we therefore show a link between the efficacy of Notch inhibition and the tumor microenvironment through LY3039478 that slows tumor progression compared to control mice blocking angiogenesis via MMP13 downregulation.
Publication Title
Crenigacestat, a selective NOTCH1 inhibitor, reduces intrahepatic cholangiocarcinoma progression by blocking VEGFA/DLL4/MMP13 axis.
Sample Metadata Fields
Specimen part, Treatment
View Samples- Mus musculus
- 2 Downloadable Samples
- Illumina HiSeq 2000
Description
The alimentary tract contains a diffuse endocrine system comprising enteroendocrine cells that secrete peptides or biogenic amines to regulate digestion, insulin secretion, food intake, and energy homeostasis. Lineage analysis in the stomach revealed that a significant fraction of endocrine cells in the gastric corpus did not arise from neurogenin3-expressing cells, unlike enteroendocrine cells elsewhere in the digestive tract. We aimed to isolate enriched serotonin-secreting and enterochromaffin-like (ECL) cells from the stomach and to clarify their cellular origin. We used Neurod1 and Neurog3 lineage analysis, and examined differentiation of serotonin-producing and ECL cells in stomach tissues of Neurod1-cre;ROSAtdTom, Tph1-CFP, c-Kitwsh/wsh, and Neurog3Cre;ROSAtdTom mice, by immunohistochemistry. We used fluorescence-activated cell sorting to isolate each cell type for gene expression analysis. We performed RNA-seq analysis of ECL cells. Neither serotonin-secreting nor ECL cells of the corpus arose from cells expressing Neurod1. Serotonin-secreting cells expressed a number of mast cell genes, but not genes associated with endocrine differentiation; they did not develop in c-Kitwsh/wsh mice and were labeled with transplanted bone marrow cells. RNA-seq analysis of ECL cells revealed high expression levels of many genes common to endocrine cells including transcription factors, hormones, ion channels, and solute transporters but not markers of bone marrow cells. Overall design: We used fluorescence-activated cell sorting to isolate Hdc+ cells from stomach corpus and performed RNA-seq for gene expression analysis to determine the origin of those cells.
Publication Title
Distinct cellular origins for serotonin-expressing and enterochromaffin-like cells in the gastric corpus.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 6 Downloadable Samples
- Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Mus musculus
- 32 Downloadable Samples
- Affymetrix Mouse Gene 1.0 ST Array (mogene10st)
Description
GEP of the murine cell line BAL17 (BALB/c)
Publication Title
Mechanisms of intracerebral lymphoma growth delineated in a syngeneic mouse model of central nervous system lymphoma.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
An inducible program of inflammatory gene expression is central to antimicrobial defenses. This response is controlled by a collaboration involving signal-dependent activation of transcription factors, transcriptional co-regulators, and chromatin-modifying factors. We have identified a long noncoding RNA (lncRNA) that acts as a key regulator of this inflammatory response. Pattern recognition receptors such as the Toll-like receptors induce the expression of numerous lncRNAs. One of these, lincRNA-Cox2, mediates both the activation and repression of distinct classes of immune genes. Transcriptional repression of target genes is dependent on interactions of lincRNA-Cox2 with heterogeneous nuclear ribonucleoprotein A/B and A2/B1. Collectively, these studies unveil a central role of lincRNA-Cox2 as a broad-acting regulatory component of the circuit that controls the inflammatory response Overall design: Examination of Mus musculus (C57BL/6 background) gene expression changes following stimulation with Pam3Cys4 in presence or absence of shRNA specifically targetting lncRNA-COX2
Publication Title
A long noncoding RNA mediates both activation and repression of immune response genes.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples- Homo sapiens
- 4 Downloadable Samples
- IlluminaGenomeAnalyzerIIx
Description
The c-MYC oncogene is a key transcription factor deregulated in most human tumors. Histone marks associated with transcriptionally active genes in euchromatic islands define the set of high-affinity c-MYC targets. The mechanisms involved in their recognition by c-MYC are not known but likely involve chromatin-remodelling and chromatin-modifying complexes. Here, we show that c-MYC interacts with BPTF, a core subunit of the NURF complex that binds active chromatin. BPTF is required for the activation of the full c-MYC transcriptional programme in fibroblasts. BPTF knockdown leads to a decrease in c-MYC recruitment to DNA and to changes in chromatin accessibility. Using BPTF-null MEFs we show that BPTF is necessary for c-MYC-driven proliferation, G1-S progression, and replication stress, but not for c-MYC-driven apoptosis. Consistently, BPTF is required for the proliferation of cells driven by c-MYC, such as Burkitt lymphoma, and its expression in human cancer lines correlates with the activation of c-MYC gene signatures. Our findings point to the c-MYC-BPTF axis as a potential therapeutic target in cancer. Overall design: To assess whether BPTF is required for the transcriptional activity of c-MYC, human foreskin fibroblasts (HFF) were stably transduced with the chimeric MYC-ER cDNA (HFF MYC-ER) and infected with lentiviruses coding for either control (shNt) or BPTF-targeting shRNAs. Cells were serum-starved for 2 days to achieve quiescence and then treated with 4-hydroxytamoxifen (4-OHT)
Publication Title
BPTF is required for c-MYC transcriptional activity and in vivo tumorigenesis.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
MLL-AF9 expression in normal human umbilical cord blood CD34+ cells leads to long-term proliferation of a myeloid progenitor cell with leukemogenic potential. Expression of a Core Binding Factor leukemia fusion (AML1-ETO or CBFbeta-SMMHC) in human CD34+ cells results in self-renewal of primitive progenitor cells with multilineage potential and stem cell ability, but these cells do not induce leukemia in immunodeficient mice. This comparative microarray study was initiated to determine how faithful these cell cultures are to the transcriptome of patient samples expressing each of these different fusion proteins, and to analyze the signaling pathways that are unique to CBF cultures and MLL-fusion cultures, with the hope of determining why the MLL-fusion cells are leukemogenic while the CBF cells are not.
Publication Title
Microenvironment determines lineage fate in a human model of MLL-AF9 leukemia.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 26 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Differences in the inherent properties of undifferentiated fat cell progenitors may contribute to the biological specificity of the abdominal subcutaneous (Sc) and visceral omental (V) fat depots. In this study, the biological characteristics of three distinct subpopulations of adipose tissue-derived stem cells (ASC), i.e. ASCSVF, ASCBottom and ASCCeiling isolated from Sc and V adipose tissue biopsies of non-obese subjects, were investigated. Genome-wide differential gene expression analysis followed by quantitative RT-PCR and analysis of cytokines in the ASC-derived conditioned medium were performed. By analysis of 28,869 annotated genes, 1,019 genes resulted differentially expressed between Sc-ASC and V-ASC. Within the Sc-ASC and V-ASC populations, 546 and 1,222, respectively, were the genes differentially expressed among ASCSVF, ASCBottom and ASCCeiling. A far more striking difference was found when the hierarchical clusters analysis was performed comparing each Sc-ASC with its own homologous V-ASC subset. mRNA levels of HoxA5, Tbx15, PI16, PITPNC1, FABP5, IL-6, IL-8, MCP-1, VEGF, MMP3, TFPI2, and ANXA10 were significantly different between Sc-ASC and V-ASC. Of the 27 cytokines measured, 14 (IL-2, IL-4, IL-5 IL-7, IL-9, IL-10, IL12, IL13, MIP1-, MIP1-, PDGF-, FGFbasic, GM-CSF, IP-10) were not released, whereas 13 were expressed (IL-1beta, IL-1ra, IL-15, IL-17, G-CSF, IFN, RANTES, TNF-, Eotaxin, IL-8, MCP-1, VEGF, IL-6), and of these, MCP-1, Eotaxin, IL-1ra, FGFbasic, IL-6, IL-8, G-CSF, and VEGF were significantly different among ASCSVF, ASCCeiling and ASCBottom of the two adipose tissue depots. These results demonstrate the existence of genetically and functionally heterogeneous fat-derived ASC populations, which may add to the complexity and specificity of Sc and V adipose tissue in humans.
Publication Title
Differences in gene expression and cytokine release profiles highlight the heterogeneity of distinct subsets of adipose tissue-derived stem cells in the subcutaneous and visceral adipose tissue in humans.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 24 Downloadable Samples
- Illumina HiSeq 2000
Description
Our studies indicate that glucose and acetate can regulate histone acetylation by altering the acetyl-CoA concentrations in the cell. The purpose of this study was to to determine whether specific gene sets correlated with acetyl-CoA availability. We conclude that 10% of glucose-regulated genes are acetyl-CoA regulated genes (genes suppressed or induced by low glucose and reversed by acetate). Acetate usually regulated gene expression in the same direction as glucose, suggesting that acetyl-CoA is a key mediator of glucose-dependent gene expression. Overall design: The experiments were performed in quadruplicates for each condition with a total of 12 samples
Publication Title
Akt-dependent metabolic reprogramming regulates tumor cell histone acetylation.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples